si:dkey-12h9.11

Ensembl ID:
ENSDARG00000043026
ZFIN ID:
ZDB-GENE-030131-8246
Description:
Novel protein similar to vertebrate tau tubulin kinase 1 (TTBK1) [Source:UniProtKB/TrEMBL;Acc:Q5SNR3
Human Orthologue:
TTBK2
Human Description:
tau tubulin kinase 2 [Source:HGNC Symbol;Acc:19141]
Mouse Orthologue:
Ttbk2
Mouse Description:
tau tubulin kinase 2 Gene [Source:MGI Symbol;Acc:MGI:2155779]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8789 Nonsense Mutation detected in F1 DNA During 2017
sa10498 Nonsense Available for shipment Available now
sa32291 Essential Splice Site Available for shipment Available now
sa23712 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063168 Nonsense 169 928 5 14
ENSDART00000138098 Nonsense 169 327 6 10
Genomic Location (Zv9):
Chromosome 20 (position 25947395)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26018698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACAGTACATGCCGAACCTGTTACATGCTCGATTTTGGATTGGCACGC[C/T]AGTTTACAAACTCATGTCAAGAAGTCCGTCCAGTAAGTAATTATAGACCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063168 Nonsense 234 928 8 14
ENSDART00000138098 Nonsense 234 327 9 10
Genomic Location (Zv9):
Chromosome 20 (position 25948374)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26019677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGAGATCTGCTGGTGTTCTCAATATCTCCCTCTATCAATACAGGAA[C/T]AAGTTGGAAATATGAAGGAGACATACAACCATCGACTCTTGCTCAAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063168 Essential Splice Site 392 928 10 14
ENSDART00000138098   None 327 None 10
Genomic Location (Zv9):
Chromosome 20 (position 25949009)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26020312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACAGTCGTGACAGAAATCTCAACCATGTTCAGCCGCAAATCAGAAAG[G/A]TATGATTCAGAAGGAATTATGATGTTAATACTATGTGTTTGTTATAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063168 Nonsense 622 928 13 14
ENSDART00000138098   None 327 None 10
Genomic Location (Zv9):
Chromosome 20 (position 25953199)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26024502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCCCGTCTCTAATGCTGTTCCCTTCACAGTCCTCCAGTGCAGCAGTA[C/T]AGACCGTTCAGCCTCAACAGAAGACAGGAGACGACTTTCAGCCTAACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link