exoc1

Ensembl ID:
ENSDARG00000043019
ZFIN ID:
ZDB-GENE-030131-1057
Description:
exocyst complex component 1 [Source:RefSeq peptide;Acc:NP_955891]
Human Orthologue:
EXOC1
Human Description:
exocyst complex component 1 [Source:HGNC Symbol;Acc:30380]
Mouse Orthologue:
Exoc1
Mouse Description:
exocyst complex component 1 Gene [Source:MGI Symbol;Acc:MGI:2445020]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3054 Essential Splice Site Available for shipment Available now
sa5673 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa3054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063154 Essential Splice Site 201 892 5 19
ENSDART00000103068 Essential Splice Site 201 892 4 18
ENSDART00000145989 None None 178 None 5
ENSDART00000063154 Essential Splice Site 201 892 5 19
ENSDART00000103068 Essential Splice Site 201 892 4 18
ENSDART00000145989 None None 178 None 5
Genomic Location:
Chromosome 20 (position 25903061)
KASP Assay ID:
554-2619.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGCCTTCGCAGAGAAACTGTCTCGTGAGCTTCAGGTCCTAGATGGGG[T/A]GAGTATGTTCAGATATTTCCTTGGCTGTAWCAGAAATTGCCCCCTAGACC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa5673
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063154 Essential Splice Site 201 892 5 19
ENSDART00000103068 Essential Splice Site 201 892 4 18
ENSDART00000145989 None None 178 None 5
ENSDART00000063154 Essential Splice Site 201 892 5 19
ENSDART00000103068 Essential Splice Site 201 892 4 18
ENSDART00000145989 None None 178 None 5
Genomic Location:
Chromosome 20 (position 25903061)
KASP Assay ID:
554-2619.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGCCTTCGCAGAGAAACTGTCTCGTGAGCTTCAGGTCCTAGATGGGG[T/A]GAGTATGTTCAGATATTTCCTTGGCTGTAWCAGAAATTGCCCCCTAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fv9zs05v