camk2d1

Ensembl ID:
ENSDARG00000043010
ZFIN ID:
ZDB-GENE-040801-121
Description:
Calcium/calmodulin-dependent protein kinase type II delta 1 chain [Source:UniProtKB/Swiss-Prot;Acc:Q
Human Orthologue:
CAMK2D
Human Description:
calcium/calmodulin-dependent protein kinase II delta [Source:HGNC Symbol;Acc:1462]
Mouse Orthologue:
Camk2d
Mouse Description:
calcium/calmodulin-dependent protein kinase II, delta Gene [Source:MGI Symbol;Acc:MGI:1341265]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25374 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056466 Essential Splice Site 73 491 3 19
ENSDART00000136175 None None 289 None 10
ENSDART00000138757 None None 245 None 5
ENSDART00000142259 Essential Splice Site 73 476 3 18
ENSDART00000148369 None None 264 None 11

The following transcripts of ENSDARG00000043010 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 59030856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAACGAGAGGCCAGAATTTGTCGTCTACTCAAGCATGCTAATATTGG[T/A]GAGTGCAACCACACACACACAAACACGCGCAAACACGCACACATGCACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/55mr7lgy