camk2d1

Ensembl ID:
ENSDARG00000043010
ZFIN ID:
ZDB-GENE-040801-121
Description:
Calcium/calmodulin-dependent protein kinase type II delta 1 chain [Source:UniProtKB/Swiss-Prot;Acc:Q
Human Orthologue:
CAMK2D
Human Description:
calcium/calmodulin-dependent protein kinase II delta [Source:HGNC Symbol;Acc:1462]
Mouse Orthologue:
Camk2d
Mouse Description:
calcium/calmodulin-dependent protein kinase II, delta Gene [Source:MGI Symbol;Acc:MGI:1341265]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25374 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41051 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056466 Essential Splice Site 73 491 3 19
ENSDART00000136175   None 289 None 10
ENSDART00000138757   None 245 None 5
ENSDART00000142259 Essential Splice Site 73 476 3 18
ENSDART00000148369   None 264 None 11

The following transcripts of ENSDARG00000043010 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 59030856)
KASP Assay ID:
554-7310.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAACGAGAGGCCAGAATTTGTCGTCTACTCAAGCATGCTAATATTGG[T/A]GAGTGCAACCACACACACACAAACACGCGCAAACACGCACACATGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056466 Essential Splice Site 314 491 12 19
ENSDART00000136175 Essential Splice Site 112 289 4 10
ENSDART00000138757   None 245 None 5
ENSDART00000142259 Essential Splice Site 314 476 12 18
ENSDART00000148369 Essential Splice Site 236 264 9 11

The following transcripts of ENSDARG00000043010 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 59092896)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTAGGGTGCTATTCTTACTACCATGCTTGCCACACGGAACTTCTCAA[G/A]TAAGAAACTATTGTATTCTGTATGTAATAATTGTTCCTTCTTTTAATTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link