gnav1

Ensembl ID:
ENSDARG00000043006
ZFIN ID:
ZDB-GENE-081031-92
Description:
Guanine nucleotide binding protein alpha subunit v1 subtypeNovel protein similar to vertebrate guani
Human Orthologues:
GNA11, GNA14, GNA15, GNAQ
Human Descriptions:
guanine nucleotide binding protein (G protein), alpha 11 (Gq class) [Source:HGNC Symbol;Acc:4379]
guanine nucleotide binding protein (G protein), alpha 14 [Source:HGNC Symbol;Acc:4382]
guanine nucleotide binding protein (G protein), alpha 15 (Gq class) [Source:HGNC Symbol;Acc:4383]
guanine nucleotide binding protein (G protein), q polypeptide [Source:HGNC Symbol;Acc:4390]
Mouse Orthologues:
Gna11, Gna14, Gna15, Gnaq
Mouse Descriptions:
guanine nucleotide binding protein, alpha 11 Gene [Source:MGI Symbol;Acc:MGI:95766]
guanine nucleotide binding protein, alpha 14 Gene [Source:MGI Symbol;Acc:MGI:95769]
guanine nucleotide binding protein, alpha 15 Gene [Source:MGI Symbol;Acc:MGI:95770]
guanine nucleotide binding protein, alpha q polypeptide Gene [Source:MGI Symbol;Acc:MGI:95776]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14474 Essential Splice Site Available for shipment Available now
sa24095 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063143 Essential Splice Site 106 362 3 9
ENSDART00000137537 Essential Splice Site 107 363 3 9
Genomic Location:
Chromosome 22 (position 11690148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGGGATGGGTGTCCTTCGCATCAACCTCGCCAACCCAAAAAACAAGG[T/A]CTGTTGCTKTCTTCACTACACTTTACAGACACAATATGTRCTTNTTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063143 Nonsense 260 362 7 9
ENSDART00000137537 Nonsense 261 363 7 9
Genomic Location:
Chromosome 22 (position 11657609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTTCAGAATCGCCTGCAGGAGAGTCTCAAGCTCTTCTCTTCAATCTG[C/A]AACAACATCTTCTTCAGGGGCACCTCCATGGTAAGAGACGAGTCTATTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xzr66ibt