try

Ensembl ID:
ENSDARG00000042993
ZFIN ID:
ZDB-GENE-010131-7
Description:
cationic trypsin-3 [Source:RefSeq peptide;Acc:NP_571783]
Human Orthologues:
PRSS1, PRSS3, PRSS37, U66059.56
Human Descriptions:
protease, serine, 1 (trypsin 1) [Source:HGNC Symbol;Acc:9475]
protease, serine, 3 [Source:HGNC Symbol;Acc:9486]
protease, serine, 37 [Source:HGNC Symbol;Acc:29211]
Trypsin-X3 [Source:UniProtKB/Swiss-Prot;Acc:Q8IYP2]
Mouse Orthologues:
1700074P13Rik, 1810009J06Rik, 2210010C04Rik, AC161768.1, BC048599, Gm10334, Gm4744, Gm5771, Prss1, Prss2, Prss3, Prss37, Try10, Try4, Try5
Mouse Descriptions:
cDNA sequence BC048599 Gene [Source:MGI Symbol;Acc:MGI:3608323]
predicted gene 10334 Gene [Source:MGI Symbol;Acc:MGI:3641889]
predicted gene 4744 Pseudogene [Source:MGI Symbol;Acc:MGI:3643181]
predicted gene 5771 Gene [Source:MGI Symbol;Acc:MGI:3646222]
protease, serine, 1 (trypsin 1) Gene [Source:MGI Symbol;Acc:MGI:98839]
protease, serine, 2 Gene [Source:MGI Symbol;Acc:MGI:102759]
protease, serine, 3 Gene [Source:MGI Symbol;Acc:MGI:102758]
protease, serine, 37 Gene [Source:MGI Symbol;Acc:MGI:1914940]
RIKEN cDNA 1700074P13 gene Gene [Source:MGI Symbol;Acc:MGI:1920731]
RIKEN cDNA 1810009J06 gene Gene [Source:MGI Symbol;Acc:MGI:1920876]
RIKEN cDNA 2210010C04 gene Gene [Source:MGI Symbol;Acc:MGI:1914623]
trypsin 10 Gene [Source:MGI Symbol;Acc:MGI:3687012]
trypsin 4 Gene [Source:MGI Symbol;Acc:MGI:102757]
trypsin 5 Gene [Source:MGI Symbol;Acc:MGI:102756]
trypsinogen 4 [Source:RefSeq peptide;Acc:NP_001096130]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16247 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063125 Essential Splice Site 198 243 4 6
ENSDART00000077661 Essential Splice Site 198 247 4 5
ENSDART00000123218 Essential Splice Site 200 249 5 6
Genomic Location:
Chromosome 16 (position 27320360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAACATGTTCTGCGCTGRTTTTATGGAGGGAGGCAAGGACTCCTGCCAG[G/A]TAAGATCACRCTTTTAATGTCTTGCAAACCAAAACACTCTTTATAGCAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatitis: Common genetic variants in the CLDN2 and PRSS1-PRSS2 loci alter risk for alcohol-related and sporadic pancreatitis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pio54lfh