crygs1

Ensembl ID:
ENSDARG00000042992
ZFIN ID:
ZDB-GENE-050223-4
Description:
crystallin, gamma S1 [Source:RefSeq peptide;Acc:NP_001013294]
Human Orthologue:
CRYGS
Human Description:
crystallin, gamma S [Source:HGNC Symbol;Acc:2417]
Mouse Orthologue:
Crygs
Mouse Description:
crystallin, gamma S Gene [Source:MGI Symbol;Acc:MGI:1298216]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43789 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016
sa4189 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37448 Nonsense Mutation detected in F1 DNA During 2016
sa4186 Nonsense Mutation detected in F1 DNA During 2016
sa37447 Nonsense Mutation detected in F1 DNA During 2016
sa3154 Nonsense F2 line generated During 2016
sa32385 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063127 Essential Splice Site 3 174 1 3
ENSDART00000145265 Missense 4 178 1 3
Genomic Location:
Chromosome 22 (position 11824181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCTTCCACAGGTGCCGCCACCAGACGAACCTCTGCAGAATGGGCCGG[G/T]TGAGTACGAAGGTGATCAGGACACTCTGCTCCAATTATTGATACTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063127   None 174 None 3
ENSDART00000145265 Essential Splice Site 7 178 1 3
Genomic Location:
Chromosome 22 (position 11824169)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGCCGCCACCAGACGAACCTCTGCAGAATGGGCCGGGTGAGTACGAAG[G/A]TGATCAGGACACTCTGCTCCAATTATTGATACTACTTTTTGATAGTCNNNGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063127 Nonsense 23 174 2 3
ENSDART00000145265 Nonsense 27 178 2 3
Genomic Location:
Chromosome 22 (position 11823839)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGAGGACAAGAATTTCCAGGGTCGTCGACACGAGTGCGATAGCGACTG[T/A]TCGGACTTCCATACGTACCTGAACCGCTGTAACTCCATCCGCGTGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063127 Nonsense 43 174 2 3
ENSDART00000145265 Nonsense 47 178 2 3
Genomic Location:
Chromosome 22 (position 11823780)
KASP Assay ID:
2261-6505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATACGTAYCTGAACCGCTGTAACTCCATCCGYGTGGAGAGTGGGGCCT[G/A]GGTGGTCTATGAGAGACCCAACTTCATAGGCTACCAGTATGTTCWGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063127 Nonsense 80 174 2 3
ENSDART00000145265 Nonsense 84 178 2 3
Genomic Location:
Chromosome 22 (position 11823670)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCGGATTACCAACGCTGGATGGGTCTGAACGACCGCCTCTGCTCCTGC[A/T]AGATGATCCACTTCGTAAGTCGCTCGCATGCATGTAAACAATTATAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3154
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063127 Nonsense 111 174 3 3
ENSDART00000145265 Nonsense 115 178 3 3
Genomic Location:
Chromosome 22 (position 11820968)
KASP Assay ID:
554-2547.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGACAAAGGAGATTTTGCCGGCCAGGTGTACGAGACCACCGAGGATTG[T/A]CCATCCGTGGTGGAGCGTTTCCGGACACGCGAGGTCCACTCCTGTAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063127 Nonsense 136 174 3 3
ENSDART00000145265 Nonsense 140 178 3 3
Genomic Location:
Chromosome 22 (position 11820893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGCGAGGTCCACTCCTGTAAGGTACTGGATGGGATCTGGATCTTCTA[C/A]GAGCACCCAAACTATAGGGGGCGCCAGTATCTGCTGCAGAAGGGGGAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link