cyp2j24

Ensembl ID:
ENSDARG00000042980
ZFIN ID:
ZDB-GENE-041001-155
Description:
cytochrome P450, family 2, subfamily J, polypeptide 24 [Source:RefSeq peptide;Acc:NP_001076518]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29364 Nonsense Mutation detected in F1 DNA During 2017
sa44940 Nonsense Mutation detected in F1 DNA During 2017
sa23707 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063107 Nonsense 88 496 2 9
Genomic Location (Zv9):
Chromosome 20 (position 25600202)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25671505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAGCATAAGACTTTTTGGACCAAGAATTGTAGTGTTGGATGGATA[T/A]AAACTGGTAAAGGAGGTGTATTTGCAACAGGGTGACAATCTGGCTGATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063107 Nonsense 140 496 3 9
Genomic Location (Zv9):
Chromosome 20 (position 25601398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGGGTATAAATGGAAGCACCAGAGACGATTTGCACTCTCAACTTTT[C/T]GAACCTTTGGATTGGGGAAGAAAAGTCTGGAGCCGTCCATTCTCCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063107 Nonsense 302 496 6 9
Genomic Location (Zv9):
Chromosome 20 (position 25602125)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25673428
KASP Assay ID:
2261-4335.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCTGCAGGGTTTGATGTGGAGAACTTGTGCATCTGTACTCTGGATT[T/A]GTTTGTAGCAGGAACTGAGACCACCTCCACCACTCTGTACTGGGGTCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link