cyp2j24

Ensembl ID:
ENSDARG00000042980
ZFIN ID:
ZDB-GENE-041001-155
Description:
cytochrome P450, family 2, subfamily J, polypeptide 24 [Source:RefSeq peptide;Acc:NP_001076518]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23707 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063107 Nonsense 302 496 6 9
Genomic Location:
Chromosome 20 (position 25602125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCTGCAGGGTTTGATGTGGAGAACTTGTGCATCTGTACTCTGGATT[T/A]GTTTGTAGCAGGAACTGAGACCACCTCCACCACTCTGTACTGGGGTCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/314uuoyf