cyp2j25

Ensembl ID:
ENSDARG00000042978
ZFIN ID:
ZDB-GENE-040426-790
Description:
cytochrome P450, family 2, subfamily J, polypeptide 25 [Source:RefSeq peptide;Acc:NP_956433]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37032 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37033 Nonsense Available for shipment Available now
sa37034 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063100   None 532 None 9
ENSDART00000124009 Essential Splice Site 111 326 4 10
ENSDART00000128416 Essential Splice Site 111 492 4 11
Genomic Location (Zv9):
Chromosome 20 (position 25593527)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25664830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAATGGTAAGTCTCGTAGCCTCATTTAAACACAGCCTTTTTGGTTTC[A/G]GTACAAATTGTAAATTGTTTTATGCACCAGATGATGGTGCATAAAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063100 Nonsense 250 532 4 9
ENSDART00000124009 Nonsense 209 326 7 10
ENSDART00000128416 Nonsense 210 492 6 11
Genomic Location (Zv9):
Chromosome 20 (position 25594037)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25665340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGACCATCACTTCCAGACTCTGCTGAACAACATCAATGAGGCTATGTA[T/A]CTGGATGGAACAATTTGGGCTCAAGTAAACAATTTTAGAGTATGACAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063100 Essential Splice Site 427 532 7 9
ENSDART00000124009   None 326 None 10
ENSDART00000128416 Essential Splice Site 387 492 9 11
Genomic Location (Zv9):
Chromosome 20 (position 25595964)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25667267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGGGCTGCTGTGAAAGATATCCAAGTTGGGAAATACTTAATTCCAAAG[G/A]TACAGTAACAATAGTTGGTGTAACATTGCATTGTACGTCTACAGACAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link