ENSDARG00000042969

Ensembl ID:
ENSDARG00000042969
Human Orthologue:
ZNF473
Human Description:
zinc finger protein 473 [Source:HGNC Symbol;Acc:23239]
Mouse Orthologue:
Zfp473
Mouse Description:
zinc finger protein 473 Gene [Source:MGI Symbol;Acc:MGI:2442697]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36126 Nonsense Mutation detected in F1 DNA During 2017
sa42721 Nonsense Mutation detected in F1 DNA During 2017
sa36128 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063087 Nonsense 138 975 4 14
Genomic Location (Zv9):
Chromosome 16 (position 27272365)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25118052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATTTTTCCAGACATGGGCATCTGATCTCTCACAAGAATGTGCACAAG[C/T]GAAATATACAGTGCTTAGTCTGCTGGGAAGTTTTTTCATCAATTGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063087 Nonsense 284 975 7 14
Genomic Location (Zv9):
Chromosome 16 (position 27273607)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25119294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAAGTTTAAGACGCCACATCCTCACTCATACAGAAGTCAAGCCATAC[C/T]AATGCAAGAACTGTAAAAGTGGTTTCTCTCGCTATGATCATTTGAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063087 Nonsense 345 975 8 14
Genomic Location (Zv9):
Chromosome 16 (position 27273870)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25119557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATGGCGATGCTCCACATTACTGATAAACCTTTTCCCTGCAAACGATG[T/A]GGCAAAACTTACAGTTCTGAAAAAACTTTGAAAAGGCATAACGACACCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link