cyp2j29

Ensembl ID:
ENSDARG00000042956
ZFIN ID:
ZDB-GENE-041001-157
Description:
cytochrome P450, family 2, subfamily J, polypeptide 29 [Source:RefSeq peptide;Acc:NP_001076405]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa498 Nonsense Available for shipment Available now
sa1587 Nonsense Available for shipment Available now
sa12054 Nonsense Available for shipment Available now
sa7935 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063064 Nonsense 230 492 5 9
Genomic Location:
Chromosome 20 (position 25558224)
KASP Assay ID:
554-0215.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGTTTGCTTTCCAGCTGTATGATGCCTTCCCAGGTATAATGAAGTG[G/A]GTGCCTGGACCTCATCAGACAATCATTTCAAACTATCAAAAGTTAGCAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063064 Nonsense 242 492 5 9
Genomic Location:
Chromosome 20 (position 25558188)
KASP Assay ID:
554-1529.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATAATGAAGTGRGTGCCTGGACCTCATCAGACAATCATTTCAAACTA[T/A]CAAAAGTTAGCAAACTTTCTGGAAGAGAAGATTGAGCAACATAAACCAGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063064 Nonsense 400 492 8 9
Genomic Location:
Chromosome 20 (position 25556415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTYCTTAAAGGGAACTGTGATGATCACAAACCTGACCTCAGTGCTGTA[T/A]GACAAAMAGGAATGGGAAACACCAGACGCCTTTAACCCTAAACACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063064 Nonsense 447 492 9 9
Genomic Location:
Chromosome 20 (position 25555678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCCACCAACAGGCAAAAGGCAGTGTCCAGGAGAGTATCTGGCTCACT[T/A]GGAGCTGTTCATCTTCCTCACCATCCTCCTGCAGACCTTCAGCTTCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4lv5mxuk