cyp2j30

Ensembl ID:
ENSDARG00000042953
ZFIN ID:
ZDB-GENE-041001-158
Description:
cytochrome P450, family 2, subfamily J, polypeptide 30 [Source:RefSeq peptide;Acc:NP_001007357]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37029 Nonsense Mutation detected in F1 DNA During 2016
sa43440 Nonsense Mutation detected in F1 DNA During 2016
sa4136 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14367 Nonsense Available for shipment Available now
sa14047 Nonsense Available for shipment Available now
sa7470 Missense Mutation detected in F1 DNA During 2016
sa37028 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 3 497 1 9
Genomic Location:
Chromosome 20 (position 25552362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCTAGGCTCACGTGGTCTGTCTTCATTCACATGCAGTCATGGCGTA[T/A]ACTGCAATACTCGAGACTCTTGATGTGAAGGGAATATTGCTGTTCATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 56 497 1 9
Genomic Location:
Chromosome 20 (position 25552205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCCCTTTCTCTGTTCCACTACTAGGAAACATCTTCAACGTTGACTCC[A/T]AAGAGCCTCATTTATATCTGACAAAGGTGAGCAGATGATATTGCCACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Essential Splice Site 119 497 2 9
Genomic Location:
Chromosome 20 (position 25551714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGATCGGCCCAACAGTCCAGTGCTAGCACGTGTGTATTCTGGAAATGG[T/C]AGGTCAACAATGTGAAAGTGTGAAAAAAGAGAAATGCTACACATGGCCTY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 170 497 3 9
ENSDART00000063058 Nonsense 170 497 3 9
Genomic Location:
Chromosome 20 (position 25549085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCTGTGAGGAGAGCCGCTTTCTTCTRGAAGAGATAGACGWACAGAAA[G/T]GTATGCAACATGCTACGGTATATACTGTAWGAASTTACCAGCTTCTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 170 497 3 9
ENSDART00000063058 Nonsense 170 497 3 9
Genomic Location:
Chromosome 20 (position 25549085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCTGTGAGGAGAGCCGCTTTCTTCTRGAAGAGATAGACGWACAGAAA[G/T]GTATGCAACATGCTACGGTATATACTGTAWGAASTTACCAGCTTCTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Missense 187 497 4 9
Genomic Location:
Chromosome 20 (position 25548043)
KASP Assay ID:
554-4045.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCTTTTGACCCAACAATCCTATTATACAATGCTGTTTCCAATWTAA[T/A]CTGTCAAATGGTGTTTGGCCAGAGATTTGACTATGCTGACCACCAGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 451 497 9 9
Genomic Location:
Chromosome 20 (position 25545194)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTCTCTCTTTCACAGGAAAGAGGGTCTGTTTGGGGGAGCAGATCGCC[A/T]GAATTGAACTCTTCCTATTTTTTGTCAGTTTGTTCCGCAAATTCAGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link