mstna

Ensembl ID:
ENSDARG00000042947
ZFIN ID:
ZDB-GENE-050208-735
Description:
myostatin a [Source:RefSeq peptide;Acc:NP_001004122]
Human Orthologue:
GDF11
Human Description:
growth differentiation factor 11 [Source:HGNC Symbol;Acc:4216]
Mouse Orthologue:
Gdf11
Mouse Description:
growth differentiation factor 11 Gene [Source:MGI Symbol;Acc:MGI:1338027]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4988 Nonsense Mutation detected in F1 DNA During 2014
sa3202 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063055 Nonsense 16 366 1 3
Genomic Location:
Chromosome 22 (position 12930175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACATGTTTCTCCTTTTTTATCTGAGCTTTTGGGGTGTGTTGGGGTCA[C/T]AAAATCAAAACCTGAGCACAACAACGACAACAACGACGCAAGCATTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063055 Nonsense 108 366 1 3
Genomic Location:
Chromosome 22 (position 12930451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCCTGGATCAGTATGACCAAAAYGGAGGCATTAGTGAGGATGAGGAA[C/T]AAGCAAGCAGCGAGACCATCATTACTATGGCCACTGAAYGTAAGTACCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pmzzjfkg