hook1

Ensembl ID:
ENSDARG00000042946
ZFIN ID:
ZDB-GENE-041001-159
Description:
Protein Hook homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5TZ80]
Human Orthologue:
HOOK1
Human Description:
hook homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19884]
Mouse Orthologue:
Hook1
Mouse Description:
hook homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925213]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23706 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063052 Nonsense 321 715 11 22
Genomic Location:
Chromosome 20 (position 25528882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTCTGACCGGGCAGTGAAGCTCGAGGCCTCTGTTGAGACCTACAGA[A/T]AGAAGTTGGAAGATTTAAGTGACCTCAGACGACAAATGAAAGCTCTGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6e35m65d