nab1a

Ensembl ID:
ENSDARG00000042940
ZFIN ID:
ZDB-GENE-050208-574
Description:
NGFI-A binding protein 1a (EGR1 binding protein 1) [Source:RefSeq peptide;Acc:NP_001038551]
Human Orthologue:
NAB1
Human Description:
NGFI-A binding protein 1 (EGR1 binding protein 1) [Source:HGNC Symbol;Acc:7626]
Mouse Orthologue:
Nab1
Mouse Description:
Ngfi-A binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:107564]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18590 Nonsense Available for shipment Available now
sa37458 Nonsense Mutation detected in F1 DNA During 2017
sa16192 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063038 Nonsense 184 521 2 8
ENSDART00000146484 Nonsense 149 486 1 7
Genomic Location (Zv9):
Chromosome 22 (position 13029770)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12865700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCAGCAGGGACGGGACTCCAGGYTGCTCGCCGTTACAAGGAGCAAGT[G/T]AAAGTCGTTTCTGGGGAAGCGAGAGCGAGCATAGTTTATCTCCATCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063038 Nonsense 333 521 3 8
ENSDART00000146484 Nonsense 298 486 2 7
Genomic Location (Zv9):
Chromosome 22 (position 13026008)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12861938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATGAACTTTTCTCACTGGCCAGGCAGATTTCTCGCGAGGTGACCTA[C/A]AAGTACAGTCGCAGGAGCAGCAGGTAAAGGGCTGGTGATCACACTCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063038 Essential Splice Site 358 521 4 8
ENSDART00000146484 Essential Splice Site 323 486 3 7
Genomic Location (Zv9):
Chromosome 22 (position 13023908)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12859838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTGYGTTGATGAAGACGAACCCTCTCCCAAACGGATTAAATCTGAAG[T/A]AAGTTTAAYCCAGCGTTCATTTGATATTCATAAACTCCACTGCTACAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link