gpr39

Ensembl ID:
ENSDARG00000042939
ZFIN ID:
ZDB-GENE-040426-1395
Description:
G-protein coupled receptor 39 [Source:RefSeq peptide;Acc:NP_956711]
Human Orthologue:
GPR39
Human Description:
G protein-coupled receptor 39 [Source:HGNC Symbol;Acc:4496]
Mouse Orthologue:
Gpr39
Mouse Description:
G protein-coupled receptor 39 Gene [Source:MGI Symbol;Acc:MGI:1918361]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9559 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063041 Nonsense 106 440 1 2
Genomic Location:
Chromosome 9 (position 58115298)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTATCTCGCTCAGGTGAMGCCGCCTGCCGCATATWCAACTTCCTGTTC[G/T]AGCTGTGCAGCTACGCCACCATTCTGAACGTGGCCACGCTGAGCCTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hypertension: Two-marker association tests yield new disease associations for coronary artery disease and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m00mncd9