si:ch211-197n1.2

Ensembl ID:
ENSDARG00000042937
ZFIN ID:
ZDB-GENE-080225-6
Description:
Novel protein (Im:7149000) [Source:UniProtKB/TrEMBL;Acc:B8JK25]
Human Orthologue:
EFCAB6
Human Description:
EF-hand calcium binding domain 6 [Source:HGNC Symbol;Acc:24204]
Mouse Orthologue:
Efcab6
Mouse Description:
EF-hand calcium binding domain 6 Gene [Source:MGI Symbol;Acc:MGI:1924877]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31200 Nonsense Available for shipment Available now
sa32639 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32638 Essential Splice Site Available for shipment Available now
sa13689 Nonsense Available for shipment Available now
sa39582 Nonsense Mutation detected in F1 DNA During 2018
sa12598 Nonsense Available for shipment Available now
sa45071 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043484   None 355 None 7
ENSDART00000114386 Nonsense 121 890 2 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16415028)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16980196
GRCz11 1 17673133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCAGCTTCAGAGAATCGCTCTATAAGCAGAGCTTCCCTTTCAACATA[C/A]TCCAGCATTGGGCCATGGAAGACAGATCAGACTGATCAGGTAGTGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043484   None 355 None 7
ENSDART00000114386 Essential Splice Site 134 890 None 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16414987)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16980155
GRCz11 1 17673092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAACATACTCCAGCATTGGGCCATGGAAGACAGATCAGACTGATCAGG[T/C]AGTGCACACATTTAACTCATGATATCTTGATAACTATATTTTAAAAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043484   None 355 None 7
ENSDART00000114386 Essential Splice Site 381 890 8 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16404855)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16970023
GRCz11 1 17662960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGATGAAGGCAGAGTTTGATAAACTGGATCCTGAAAGCACCGGAAAG[G/A]TAGCAAACAGTGTCACACCTCTCAAACAAACAGGTAGAAAAATGGTAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043484   None 355 None 7
ENSDART00000114386 Nonsense 396 890 9 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16401389)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16966557
GRCz11 1 17659494
KASP Assay ID:
2259-0387.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCAGGTGAGAGGTGCGGACTTTCTGCAGGTGTTGGGAAAGTTTGAWT[T/A]GCAWCTGAAAAGAGAGCAGCTGGGTCTGTTTCTGTCTCGCTGTGGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043484   None 355 None 7
ENSDART00000114386 Nonsense 401 890 9 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16401375)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16966543
GRCz11 1 17659480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGGACTTTCTGCAGGTGTTGGGAAAGTTTGATTTGCATCTGAAAAGA[G/T]AGCAGCTGGGTCTGTTTCTGTCTCGCTGTGGTCTGAAGATTAAAAAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043484 Nonsense 163 355 4 7
ENSDART00000114386 Nonsense 698 890 15 18
Genomic Location (Zv9):
Chromosome 1 (position 16366038)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16931206
GRCz11 1 17624143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACAGACTCAGCTATGTCTCAGATATRCTGGTGGATGCTCTGCGGGCC[A/T]AGGTRAGGCTGTACTKTMAAAATACTCACTGTAAGAGTTCARATTACTCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043484 Nonsense 252 355 6 7
ENSDART00000114386 Nonsense 787 890 17 18
Genomic Location (Zv9):
Chromosome 1 (position 16361666)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16926834
GRCz11 1 17619771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGATATGGAAGCATGGATCCAATATGGCAGCTGCTCTGCAGACTCCC[A/T]GAGAAAATCAAGAAATTGCCACCCCGGAAACACTAAACCGCAACATTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link