ctgf

Ensembl ID:
ENSDARG00000042934
ZFIN ID:
ZDB-GENE-030131-102
Description:
connective tissue growth factor [Source:RefSeq peptide;Acc:NP_001015041]
Human Orthologue:
CTGF
Human Description:
connective tissue growth factor [Source:HGNC Symbol;Acc:2500]
Mouse Orthologue:
Ctgf
Mouse Description:
connective tissue growth factor Gene [Source:MGI Symbol;Acc:MGI:95537]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25135 Nonsense Mutation detected in F1 DNA During 2014
sa7934 Nonsense Mutation detected in F1 DNA During 2014
sa11839 Nonsense Available for shipment Available now
sa13699 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063028 Nonsense 184 345 4 5
Genomic Location:
Chromosome 20 (position 25371609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGTAACATCTTATTGCTTCTTGTAGCTTACAGAGAGGAGGAGACATA[C/A]GGTCCCGATCCCTCCATGATGAGAGAGAACTGCCTGGTTCAGACTACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063028 Nonsense 250 345 5 5
Genomic Location:
Chromosome 20 (position 25371912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAACTGAGCTTTATGGTTAACCTTCATTTTTTATCTTTCCAGAAAGGG[A/T]AAAAGTGCATCCGCACACCAMGAGTCTCCAAACCCATGAAGTTTGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063028 Nonsense 260 345 5 5
ENSDART00000063028 Nonsense 260 345 5 5
Genomic Location:
Chromosome 20 (position 25371942)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATCTTTCCAGAAAGGGWAAAAGTGCATCCGCACACCAMGAGTCTCC[A/T]AACCCATGAAGTTTGAGATTWCCGGCTGTACCACTACCAAGTCTTACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063028 Nonsense 260 345 5 5
ENSDART00000063028 Nonsense 260 345 5 5
Genomic Location:
Chromosome 20 (position 25371942)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATCTTTCCAGAAAGGGWAAAAGTGCATCCGCACACCAMGAGTCTCC[A/T]AACCCATGAAGTTTGAGATTWCCGGCTGTACCACTACCAAGTCTTACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hpvdirx7