pldn

Ensembl ID:
ENSDARG00000042933
ZFIN ID:
ZDB-GENE-070112-1862
Description:
pallidin homolog [Source:RefSeq peptide;Acc:NP_001074166]
Human Orthologue:
PLDN
Human Description:
pallidin homolog (mouse) [Source:HGNC Symbol;Acc:8549]
Mouse Orthologue:
Pldn
Mouse Description:
pallidin Gene [Source:MGI Symbol;Acc:MGI:1927580]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36559 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23209 Essential Splice Site Available for shipment Available now
sa43030 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063024 Essential Splice Site 82 143 3 6
ENSDART00000142945 Essential Splice Site 86 156 3 5
ENSDART00000063024 Essential Splice Site 82 143 3 6
ENSDART00000142945 Essential Splice Site 86 156 3 5
Genomic Location (Zv9):
Chromosome 18 (position 4933251)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5653795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCACGAAATTCCGCGACTGCAACGCCATGATTGATCTGAACGCGCTGG[T/C]GAGTGTTTAACCGTGTGTTTTCTCATAAGATCCTCCTGTGTTGATCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063024 Essential Splice Site 82 143 3 6
ENSDART00000142945 Essential Splice Site 86 156 3 5
ENSDART00000063024 Essential Splice Site 82 143 3 6
ENSDART00000142945 Essential Splice Site 86 156 3 5
Genomic Location (Zv9):
Chromosome 18 (position 4933251)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5653795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCACGAAATTCCGCGACTGCAACGCCATGATTGATCTGAACGCGCTGG[T/C]GAGTGTTTAACCGTGTGTTTTCTCATAAGATCCTCCTGTGTTGATCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063024 Essential Splice Site 112 143 None 6
ENSDART00000142945 Essential Splice Site 116 156 None 5
Genomic Location (Zv9):
Chromosome 18 (position 4933514)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5653532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCGGAAAACACACTGAAACATTTACACGTGTGTGTTTTACTGTGTGT[A/T]GAAGCGAGCGCTGAAGCTGCAGCAGCACAAACAGAAGGAGGAGCTGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link