mfng

Ensembl ID:
ENSDARG00000042925
ZFIN ID:
ZDB-GENE-041130-1
Description:
Beta-1,3-N-acetylglucosaminyltransferase manic fringe [Source:UniProtKB/Swiss-Prot;Acc:Q5YB40]
Human Orthologue:
MFNG
Human Description:
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:7038]
Mouse Orthologue:
Mfng
Mouse Description:
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Gene [Source:MGI Symbol;Acc:MGI:1095404

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24114 Nonsense Mutation detected in F1 DNA During 2014
sa10647 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063008 Nonsense 139 360 3 8
Genomic Location:
Chromosome 22 (position 15409909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCATGTGTGTTTTTGTCAACAGGTTTTAACGTTGTCGTCACTAATTG[T/A]TCACCTGAGCACAGTCATCAAGCATTATCCTGCAAGATGGCTGCTGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063008 Essential Splice Site 165 360 3 8
Genomic Location:
Chromosome 22 (position 15409831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGCAAGATGGCTGCTGAGTATGACTACTTCATGGCCTCCTACAAAAA[G/A]TGAGTAAGCTAATGGTGCTAWWAWTTTTCTCAAGATTTTGAATGTTCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/17pluxvi