mfng

Ensembl ID:
ENSDARG00000042925
ZFIN ID:
ZDB-GENE-041130-1
Description:
Beta-1,3-N-acetylglucosaminyltransferase manic fringe [Source:UniProtKB/Swiss-Prot;Acc:Q5YB40]
Human Orthologue:
MFNG
Human Description:
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:7038]
Mouse Orthologue:
Mfng
Mouse Description:
MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Gene [Source:MGI Symbol;Acc:MGI:1095404

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24114 Nonsense Mutation detected in F1 DNA During 2016
sa10647 Essential Splice Site Available for shipment Available now
sa37469 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063008 Nonsense 139 360 3 8
Genomic Location:
Chromosome 22 (position 15409909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCATGTGTGTTTTTGTCAACAGGTTTTAACGTTGTCGTCACTAATTG[T/A]TCACCTGAGCACAGTCATCAAGCATTATCCTGCAAGATGGCTGCTGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063008 Essential Splice Site 165 360 3 8
Genomic Location:
Chromosome 22 (position 15409831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGCAAGATGGCTGCTGAGTATGACTACTTCATGGCCTCCTACAAAAA[G/A]TGAGTAAGCTAATGGTGCTAWWAWTTTTCTCAAGATTTTGAATGTTCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063008 Nonsense 262 360 6 8
Genomic Location:
Chromosome 22 (position 15402721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCCAGGTTTGAACAAACATCTGCTGTGATAATGTTGCCTGATGACTG[T/A]ACCGTGGGTTTTATAGTTGAGAGGCGACTGGGCATCTCGATGATCCATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link