gpr173

Ensembl ID:
ENSDARG00000042922
ZFIN ID:
ZDB-GENE-000710-1
Description:
Probable G-protein coupled receptor 173 [Source:UniProtKB/Swiss-Prot;Acc:Q9I918]
Human Orthologue:
GPR173
Human Description:
G protein-coupled receptor 173 [Source:HGNC Symbol;Acc:18186]
Mouse Orthologue:
Gpr173
Mouse Description:
G-protein coupled receptor 173 Gene [Source:MGI Symbol;Acc:MGI:1918021]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15828 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063005 Nonsense 111 387 1 1
Genomic Location:
Chromosome 8 (position 24268899)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGTCCATCAAGAACGGCTCGGCCTGGACTTACAGCGTGCTCAGCTGC[A/T]AGGTGGTGGCCTTCATGGCCGTCCTTTTCTGCTTCCATGCTGCCTTCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/idp6i9a6