lifra

Ensembl ID:
ENSDARG00000042909
ZFIN ID:
ZDB-GENE-050327-16
Description:
leukemia inhibitory factor receptor alpha [Source:RefSeq peptide;Acc:NP_001014328]
Human Orthologue:
LIFR
Human Description:
leukemia inhibitory factor receptor alpha [Source:HGNC Symbol;Acc:6597]
Mouse Orthologue:
Lifr
Mouse Description:
leukemia inhibitory factor receptor Gene [Source:MGI Symbol;Acc:MGI:96788]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5281 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062985 Nonsense 150 939 5 18
ENSDART00000141258 Nonsense 150 930 5 18
Genomic Location:
Chromosome 5 (position 7855072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCCCAGGATAAGGTGGTTCYAGTGGGCAGTAACATGACCTTCTGCTG[T/A]ATTGTGAAGGAGAAGGACTCTTTYAAAAGTATCAAGTATGGCGATCGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r215dce7