hsh2d

Ensembl ID:
ENSDARG00000042908
ZFIN ID:
ZDB-GENE-050410-3
Description:
Hematopoietic SH2 domain-containing protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q56A36]
Human Orthologue:
HSH2D
Human Description:
hematopoietic SH2 domain containing [Source:HGNC Symbol;Acc:24920]
Mouse Orthologue:
Hsh2d
Mouse Description:
hematopoietic SH2 domain containing Gene [Source:MGI Symbol;Acc:MGI:2676364]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12555 Nonsense Available for shipment Available now
sa12550 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062986 Nonsense 99 365 4 6
ENSDART00000062986 Nonsense 99 365 4 6
Genomic Location:
Chromosome 22 (position 15722078)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGTATTGCCAGATAACCAGTTTATGATAGTGGGAGAAAAGACRGTGTA[T/G]TGTTCCCTTCATGACTTGGTGGCTTTCCATCGCAGATGCCCTATTCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062986 Nonsense 99 365 4 6
ENSDART00000062986 Nonsense 99 365 4 6
Genomic Location:
Chromosome 22 (position 15722078)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGTATTGCCAGATAACCAGTTTATGATAGTGGGAGAAAAGACRGTGTA[T/G]TGTTCCCTTCATGACTTGGTGGCTTTCCATCGCAGATGCCCTATTCTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sxsix8ad