osmr

Ensembl ID:
ENSDARG00000042903
ZFIN ID:
ZDB-GENE-060526-48
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CE45]
Human Orthologue:
OSMR
Human Description:
oncostatin M receptor [Source:HGNC Symbol;Acc:8507]
Mouse Orthologue:
Osmr
Mouse Description:
oncostatin M receptor Gene [Source:MGI Symbol;Acc:MGI:1330819]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20341 Nonsense Available for shipment Available now
sa723 Essential Splice Site Available for shipment Available now
sa20340 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097178 Nonsense 83 674 3 12
ENSDART00000133270 Nonsense 48 781 2 13
Genomic Location:
Chromosome 5 (position 7804188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTATTCAACTGTAGATAATTGATTTTTTTACTGGTTTTCCTGCAGGC[G/T]AGGTGAGCTCGGATGAAATCCTGCTGTTTCCAGATGACCAGGTGTTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097178 Essential Splice Site 382 674 8 12
ENSDART00000133270 Essential Splice Site 347 781 7 13
Genomic Location:
Chromosome 5 (position 7790841)
KASP Assay ID:
554-0631.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAATCAAGAAACATCCCAATCGCAACATCACACTTCTGTGGAAACCTG[T/C]AAGTTTATTTTTCTTATCCTTTTTGTCATCAACTAAACANNNCAGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097178 Essential Splice Site 602 674 11 12
ENSDART00000133270 Essential Splice Site 567 781 10 13
Genomic Location:
Chromosome 5 (position 7785871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTACAGGATATGTGATCAGAGTCCGTTCAGAAAGCGGTTCTGAACTCC[G/A]TGAGTGTGACATTGCTCCTAAATGAGAAATTAAACACTCACTACACTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ovpuutpi