lace1b

Ensembl ID:
ENSDARG00000042902
ZFIN ID:
ZDB-GENE-041014-178
Description:
Lactation elevated protein 1 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q5TYS0]
Human Orthologue:
LACE1
Human Description:
lactation elevated 1 [Source:HGNC Symbol;Acc:16411]
Mouse Orthologue:
Lace1
Mouse Description:
lactation elevated 1 Gene [Source:MGI Symbol;Acc:MGI:2148801]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19238 Nonsense Mutation detected in F1 DNA During 2014
sa17857 Essential Splice Site Available for shipment Available now
sa4103 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062978 Nonsense 77 503 2 13
ENSDART00000123973 Nonsense 90 516 2 13
Genomic Location:
Chromosome 20 (position 32442454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACTATGACAGCCTTGTCCACTTCGGTTCACTCCGAAAGGACCCGCAA[C/T]AGAGAACTGCACTTCTTCAGTTAGAAGAATTAACCAGAGTGCTGACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062978 Essential Splice Site 238 503 5 13
ENSDART00000123973 Essential Splice Site 251 516 5 13
Genomic Location:
Chromosome 20 (position 32436983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGGAGATTGCAGAGGAAACCTGTCTCATATGCTTTGATGAGTTTCAG[G/A]TRAGGGCAGAAGTAGGGAAATTGTAAAAAAAAAAAAAAAAATTGTTGAWG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062978 Nonsense 466 503 13 13
ENSDART00000123973 Nonsense 479 516 13 13
Genomic Location:
Chromosome 20 (position 32376804)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAATAACTGCTTATTAAAATTCATTTATTTGTTCAGGAGGCCAGYAAG[C/T]GAATTACTCTGTTCACTGCGGATGAAGAGATCTTTGCCTTCCAGAGGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xbu6k2wr