gtpbp1l

Ensembl ID:
ENSDARG00000042900
ZFIN ID:
ZDB-GENE-041007-2
Description:
GTP binding protein 1, like [Source:RefSeq peptide;Acc:NP_001019982]
Human Orthologue:
GTPBP1
Human Description:
GTP binding protein 1 [Source:HGNC Symbol;Acc:4669]
Mouse Orthologue:
Gtpbp1
Mouse Description:
GTP binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:109443]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37468 Nonsense Mutation detected in F1 DNA During 2017
sa8398 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062970 Nonsense 69 642 2 11
ENSDART00000122740 Nonsense 74 647 2 11
ENSDART00000125550 Nonsense 79 652 3 12
Genomic Location (Zv9):
Chromosome 22 (position 14982978)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14813526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTTGTCAGTTTGCGCTGGTCAGCCCCACAGGAGAGCAGTATGACTG[T/A]TTACAAAAACAGTTGCGAGAGCGAATAGAGGAAGGATGTGGAGAAACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062970 Essential Splice Site 270 642 4 11
ENSDART00000122740 Essential Splice Site 275 647 4 11
ENSDART00000125550 Essential Splice Site 280 652 5 12
Genomic Location (Zv9):
Chromosome 22 (position 14987738)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14818286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGTATTCGGGATGACAGGCCACTTGCCGGATTTCTGCATGCTAATGG[T/C]GAGAGGCAGTAGGTGTGCCACAAGTGTATGTACCGGGTGGTTTAAAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link