si:ch211-163l21.8

Ensembl ID:
ENSDARG00000042899
ZFIN ID:
ZDB-GENE-041008-93
Description:
Novel protein (Im:7136654) [Source:UniProtKB/TrEMBL;Acc:A8Y5S9]
Human Orthologue:
KIAA1324
Human Description:
KIAA1324 [Source:HGNC Symbol;Acc:29618]
Mouse Orthologue:
5330417C22Rik
Mouse Description:
RIKEN cDNA 5330417C22 gene Gene [Source:MGI Symbol;Acc:MGI:1923930]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34396 Nonsense Mutation detected in F1 DNA During 2017
sa21284 Essential Splice Site Available for shipment Available now
sa27198 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa34397 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062968 Nonsense 243 906 7 21
ENSDART00000124686 Nonsense 112 190 4 7
ENSDART00000137820   None 309 None 8
ENSDART00000144229 Nonsense 282 593 7 13
Genomic Location (Zv9):
Chromosome 8 (position 24648006)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23773824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGAGCTTGTACACAGAGACCGGCCTGCAAAACCTCTGATTACTTCTA[C/A]ACCCACACACCCTGTGATTCCAGCGCTCAGGTAACATGTAAAAACAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062968 Essential Splice Site 253 906 None 21
ENSDART00000124686 Essential Splice Site 122 190 None 7
ENSDART00000137820   None 309 None 8
ENSDART00000144229 Essential Splice Site 292 593 None 13
Genomic Location (Zv9):
Chromosome 8 (position 24648038)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23773856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTCTGATTACTTCTACACCCACACACCCTGTGATTCCAGCGCTCAGG[T/C]AACATGTAAAAACAAACACTGATAGTCTTTGTGTCGGAAAGCACTAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062968 Splice Site, Nonsense 554 906 13 21
ENSDART00000124686   None 190 None 7
ENSDART00000137820   None 309 None 8
ENSDART00000144229 Nonsense 593 593 13 13
Genomic Location (Zv9):
Chromosome 8 (position 24653973)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23779791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCGGAAAAGAAGCCTGCATTCCTTGTGGACCTAATACATACAGCAAT[A/T]AAGTAGGCACTACCTATGATTAATTAAATGTTGATTGATTATTATACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062968 Nonsense 759 906 18 21
ENSDART00000124686   None 190 None 7
ENSDART00000137820 Nonsense 161 309 5 8
ENSDART00000144229   None 593 None 13
Genomic Location (Zv9):
Chromosome 8 (position 24657183)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23783001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGGCGCTCACAGCAGGCCTGTCCTCTCTGCTCAGAAAGTAACTAT[A/T]AGGAGATTGTCAGCGCCTGCATCCAGGGAATTCAGGTGCAGAAAACATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link