si:ch211-222f23.6

Ensembl ID:
ENSDARG00000042880
ZFIN ID:
ZDB-GENE-070912-208
Description:
hypothetical protein LOC100141493 [Source:RefSeq peptide;Acc:NP_001120876]
Human Orthologues:
PVR, PVRL1, PVRL2, PVRL3
Human Descriptions:
poliovirus receptor [Source:HGNC Symbol;Acc:9705]
poliovirus receptor-related 1 (herpesvirus entry mediator C) [Source:HGNC Symbol;Acc:9706]
poliovirus receptor-related 2 (herpesvirus entry mediator B) [Source:HGNC Symbol;Acc:9707]
poliovirus receptor-related 3 [Source:HGNC Symbol;Acc:17664]
Mouse Orthologues:
Pvr, Pvrl1, Pvrl2, Pvrl3
Mouse Descriptions:
poliovirus receptor Gene [Source:MGI Symbol;Acc:MGI:107741]
poliovirus receptor-related 1 Gene [Source:MGI Symbol;Acc:MGI:1926483]
poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]
poliovirus receptor-related 3 Gene [Source:MGI Symbol;Acc:MGI:1930171]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34540 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062940 Nonsense 350 367 6 6
Genomic Location (Zv9):
Chromosome 9 (position 1474968)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1484021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGTGTCATCTTCATTGTTGTCCTCTGCTCTTCTGTGGTCCTCAAATA[T/G]TCAAGTGGTAGAAAAACTTGTGGTGTGCTTATTAAGAAACAGGGGCGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link