heca

Ensembl ID:
ENSDARG00000042877
ZFIN ID:
ZDB-GENE-041001-173
Description:
headcase protein homolog [Source:RefSeq peptide;Acc:NP_001038591]
Human Orthologue:
HECA
Human Description:
headcase homolog (Drosophila) [Source:HGNC Symbol;Acc:21041]
Mouse Orthologue:
Heca
Mouse Description:
headcase homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2685715]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18612 Nonsense Available for shipment Available now
sa3059 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa18612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062935 Nonsense 225 523 2 4
Genomic Location:
Chromosome 20 (position 36853699)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCCAGTCAGGAGCTTTCAYGCAGACAATCAGCAGATTGGCAGAACTG[T/A]CAGGAGCGATGTCACGCTGGTCCTCTCAATGCAGTCRGTGGGATGTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3059
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062935 Nonsense 499 523 4 4
Genomic Location:
Chromosome 20 (position 36863260)
KASP Assay ID:
554-2687.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGATGTACGTGTGGGTATGCAGTATTTTTCCGAGTACAGCAATGTACAG[C/T]AGTGTCCTCACTGCGGCAATCTGGACTATCACTTTGTAAAGCCATTCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6zgbijgu