heca

Ensembl ID:
ENSDARG00000042877
ZFIN ID:
ZDB-GENE-041001-173
Description:
headcase protein homolog [Source:RefSeq peptide;Acc:NP_001038591]
Human Orthologue:
HECA
Human Description:
headcase homolog (Drosophila) [Source:HGNC Symbol;Acc:21041]
Mouse Orthologue:
Heca
Mouse Description:
headcase homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2685715]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37115 Nonsense Mutation detected in F1 DNA During 2016
sa18612 Nonsense Available for shipment Available now
sa3059 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa37115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062935 Nonsense 39 523 1 4
Genomic Location (Zv9):
Chromosome 20 (position 36845826)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36918339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAATGGAGCCTCTGCGTCTGGGGTTACGGGAGGAACTGCCTCGACGT[T/A]GACCGGAGCCACGGCGGGTCCGCCGAGCGACAACAGAAGCGGTAAGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062935 Nonsense 225 523 2 4
Genomic Location (Zv9):
Chromosome 20 (position 36853699)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36926212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCCAGTCAGGAGCTTTCAYGCAGACAATCAGCAGATTGGCAGAACTG[T/A]CAGGAGCGATGTCACGCTGGTCCTCTCAATGCAGTCRGTGGGATGTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3059
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062935 Nonsense 499 523 4 4
Genomic Location (Zv9):
Chromosome 20 (position 36863260)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36935773
KASP Assay ID:
554-2687.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGATGTACGTGTGGGTATGCAGTATTTTTCCGAGTACAGCAATGTACAG[C/T]AGTGTCCTCACTGCGGCAATCTGGACTATCACTTTGTAAAGCCATTCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link