c6orf115

Ensembl ID:
ENSDARG00000042876
ZFIN ID:
ZDB-GENE-030131-8594
Description:
UPF0727 protein C6orf115 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6TGV7]
Human Orthologue:
C6orf115
Human Description:
chromosome 6 open reading frame 115 [Source:HGNC Symbol;Acc:21230]
Mouse Orthologue:
3110003A17Rik
Mouse Description:
RIKEN cDNA 3110003A17 gene Gene [Source:MGI Symbol;Acc:MGI:1920362]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23770 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062931 Nonsense 25 81 3 3
ENSDART00000147466 Nonsense 25 81 2 2
Genomic Location:
Chromosome 20 (position 36841038)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTACAGTGATCCCTGACCCATTCTCTCTATCTTGCAGATGCAGACGGG[A/T]AGACCAGCGTCAAATTCGGAGTCTTGTTTAACGATGACCAGTGCGCCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3de480ho