ltk

Ensembl ID:
ENSDARG00000042861
ZFIN ID:
ZDB-GENE-030616-115
Description:
leukocyte tyrosine kinase receptor [Source:RefSeq peptide;Acc:NP_001006661]
Human Orthologue:
ALK
Human Description:
anaplastic lymphoma receptor tyrosine kinase [Source:HGNC Symbol;Acc:427]
Mouse Orthologue:
Alk
Mouse Description:
anaplastic lymphoma kinase Gene [Source:MGI Symbol;Acc:MGI:103305]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9910 Nonsense Available for shipment Available now
sa1500 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061547 Nonsense 232 1530 6 28
ENSDART00000062907 Nonsense 232 1504 6 29
ENSDART00000111621 Nonsense 232 1504 6 29
Genomic Location:
Chromosome 17 (position 31505168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGTGGWTTTCTGCAGGTGATGATTATGTGGATTTGGGTTCCGACTG[T/A]GAGAAATACTCATCTCTTCAATGTCATTCTGGAGGCTGCATTGAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061547 Nonsense 898 1530 19 28
ENSDART00000062907 Nonsense 872 1504 20 29
ENSDART00000111621 Nonsense 872 1504 20 29
Genomic Location:
Chromosome 17 (position 31469392)
KASP Assay ID:
554-1425.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGAACCACCTGCATGCGGTCAGGATTCGACTGCAGAGTCCAGAGTAC[A/T]AGCTTAGCAAAATTCGCTCGTCCACCATCATGACCGACTACAACCCCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e2iitj0r