itpka

Ensembl ID:
ENSDARG00000042856
ZFIN ID:
ZDB-GENE-030616-116
Description:
Novel protein similar to vertebrate inositol 1,4,5-triphosphate 3-kinase (ITPKA) [Source:UniProtKB/T
Human Orthologue:
ITPKA
Human Description:
inositol 1,4,5-trisphosphate 3-kinase A [Source:HGNC Symbol;Acc:6178]
Mouse Orthologue:
Itpka
Mouse Description:
inositol 1,4,5-trisphosphate 3-kinase A Gene [Source:MGI Symbol;Acc:MGI:1333822]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11744 Nonsense Available for shipment Available now
sa23119 Nonsense Mutation detected in F1 DNA During 2014
sa23120 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062900 Nonsense 173 448 2 7
Genomic Location:
Chromosome 17 (position 31432749)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACTGAAGACTATTGTTAAGTGCCCTTTGGTGGCTTCACAACGAAGA[C/T]GACTGTCATGGGTTCAGTTAGCAGGCCATAAAGGTAAAAYCATTCTAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062900 Nonsense 207 448 3 7
Genomic Location:
Chromosome 17 (position 31435610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGGCTCCATACTGAAGAAGTTCTCTGAAAATGAGAATCGCTGTTTC[G/T]AGAGGCTCAAAGAGGATGCTTTACATGGCTTCGTGCCCGGATACTATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062900 Nonsense 264 448 4 7
Genomic Location:
Chromosome 17 (position 31444144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTGTCTTTTGTTCTCTGTCAGGACGTATCTGGAGGATGAGCTGGTT[C/T]GAGCACGAGTGAAGCCAAAGCTGCGGGAGGACTTGTATAATAAGATGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lrfstdu2