nphs2

Ensembl ID:
ENSDARG00000042850
ZFIN ID:
ZDB-GENE-051102-2
Description:
podocin [Source:RefSeq peptide;Acc:NP_001018155]
Human Orthologue:
NPHS2
Human Description:
nephrosis 2, idiopathic, steroid-resistant (podocin) [Source:HGNC Symbol;Acc:13394]
Mouse Orthologue:
Nphs2
Mouse Description:
nephrosis 2 homolog, podocin (human) Gene [Source:MGI Symbol;Acc:MGI:2157018]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24139 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062891 Nonsense 134 391 2 8
ENSDART00000136119 Nonsense 147 406 2 8

The following transcripts of ENSDARG00000042850 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17476119)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17227877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGTTTTGGTCCTGTCAGTGGTCATCCTTTTCTTACCGATTTCAGTATG[G/A]TTCTGTGTGAAGGTATGATTTTGCTTTGGGATTAAATATTAGACATGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link