disp2

Ensembl ID:
ENSDARG00000042846
ZFIN ID:
ZDB-GENE-030915-1
Description:
Protein dispatched homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6R5J1]
Human Orthologue:
DISP2
Human Description:
dispatched homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:19712]
Mouse Orthologue:
Disp2
Mouse Description:
dispatched homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2388733]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23117 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062887 Nonsense 360 1476 8 8
ENSDART00000125872 Nonsense 361 1477 8 8
Genomic Location (Zv9):
Chromosome 17 (position 31258025)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31181952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCCATGGTGAAGAATGAGTGCTGTCCAAGTTGGTCCTTGGGAAACTA[C/A]TTGGCTGTCCTCAACAACATTTCTTCCTGCTTTAGTCTGACTTCACAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link