oxtl

Ensembl ID:
ENSDARG00000042845
ZFIN ID:
ZDB-GENE-030407-1
Description:
oxytocin-neurophysin 1 [Source:RefSeq peptide;Acc:NP_840076]
Human Orthologues:
AVP, OXT
Human Descriptions:
arginine vasopressin [Source:HGNC Symbol;Acc:894]
oxytocin, prepropeptide [Source:HGNC Symbol;Acc:8528]
Mouse Orthologues:
Avp, Oxt
Mouse Descriptions:
arginine vasopressin Gene [Source:MGI Symbol;Acc:MGI:88121]
oxytocin Gene [Source:MGI Symbol;Acc:MGI:97453]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20598 Essential Splice Site Available for shipment Available now
sa33779 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062885 Essential Splice Site 108 154 3 4
Genomic Location (Zv9):
Chromosome 5 (position 75206833)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71308075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGGTTATGAGGGACGCTGCGCTGCTCCTGGAGTCTGCTGCGACTCGG[G/A]TTAGTTTCAGCTCAAATTCAATTGACTCCAGAACAAACCACTGTTATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062885 Nonsense 120 154 4 4
Genomic Location (Zv9):
Chromosome 5 (position 75207220)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71308462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTCTCAGAGGGCTGCAGTGTGGACCAGTCGTGTGTGGAC[G/T]GAGATGCTGACGCTGCAGCTGTCAATCAACCGGCCAACAGCCCAGATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link