eml1

Ensembl ID:
ENSDARG00000042840
ZFIN ID:
ZDB-GENE-060929-156
Description:
echinoderm microtubule-associated protein-like 1 [Source:RefSeq peptide;Acc:NP_001180527]
Human Orthologue:
EML1
Human Description:
echinoderm microtubule associated protein like 1 [Source:HGNC Symbol;Acc:3330]
Mouse Orthologue:
Eml1
Mouse Description:
echinoderm microtubule associated protein like 1 Gene [Source:MGI Symbol;Acc:MGI:1915769]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36453 Nonsense Mutation detected in F1 DNA During 2016
sa13937 Nonsense Available for shipment Available now
sa16731 Nonsense Available for shipment Available now
sa14062 Nonsense Available for shipment Available now
sa36452 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104307 Nonsense 233 281 7 7
ENSDART00000126414   None 813 None 22
ENSDART00000134998   None 101 None 3

The following transcripts of ENSDARG00000042840 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 31059353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCTCGCAGTCCACCAACAACCCATCAGAGGTCAAGATTCTGTCTGAC[A/T]GAGCGGCCCGACTCGGATACCGAAAGATCCCTCCGTTTAGTCTTCCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104307   None 281 None 7
ENSDART00000126414 Nonsense 212 813 6 22
ENSDART00000134998   None 101 None 3

The following transcripts of ENSDARG00000042840 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 31056904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KCACCATGTACATGCCCAAAGACCTGGTGGAYACTTATTGCCTGGAAACT[A/T]AAGCTGACTWGCCTCCTAAAAAACTGAAGCTAGACTGGGTGTATCCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104307   None 281 None 7
ENSDART00000126414 Nonsense 215 813 6 22
ENSDART00000134998   None 101 None 3

The following transcripts of ENSDARG00000042840 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 31056894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCCCAAAGACCTGGTGGAYACTTATTGCCTGGAAACTWAAGCTGACT[T/A]GCCTCCTAAAAAACTGAAGCTAGACTGGGTGTATCCTTTAATGCTGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104307   None 281 None 7
ENSDART00000126414 Nonsense 362 813 10 22
ENSDART00000134998   None 101 None 3

The following transcripts of ENSDARG00000042840 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 31048288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACYCCAATGACCACATGCTCTCTGTGTGGGACTGGCAGAGGGAAGAC[A/T]GAYTCGCTGAAGTCAAGGTGAGYGCTTCAGTATTCAGCATAGATTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104307   None 281 None 7
ENSDART00000126414 Essential Splice Site 635 813 17 22
ENSDART00000134998   None 101 None 3

The following transcripts of ENSDARG00000042840 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 31041927)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCACACGGATGGGAATGAACAGCTGTCTGTGATCCGCTTTTCTCCGGG[T/C]TAGAGTTACTTCTCCCTGCAGCTTTTTTTCTTTTTGCTGGGAAAACATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link