tfdp2

Ensembl ID:
ENSDARG00000042835
ZFIN ID:
ZDB-GENE-030219-104
Description:
transcription factor Dp-2 [Source:RefSeq peptide;Acc:NP_937851]
Human Orthologue:
TFDP2
Human Description:
transcription factor Dp-2 (E2F dimerization partner 2) [Source:HGNC Symbol;Acc:11751]
Mouse Orthologue:
Tfdp2
Mouse Description:
transcription factor Dp 2 Gene [Source:MGI Symbol;Acc:MGI:107167]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6362 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19100 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062868 Essential Splice Site 56 414 4 13
ENSDART00000128602 Essential Splice Site 56 408 5 14
Genomic Location:
Chromosome 15 (position 4331990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATAARTTCCCTAAACTGCTTGCTTTTTTNGTGTATTATTTGTGTCTGC[A/T]GATTTTAAGCACACCACAGAGAGTCTCTCACTCTGGAAATATCCTCATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062868 Essential Splice Site 99 414 4 13
ENSDART00000128602 Essential Splice Site 99 408 5 14
Genomic Location:
Chromosome 15 (position 4331856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGGTTACTCAGGCACACCCACCCGAAGGCAACGAGTGGACCCCGGGG[T/C]GAGCAAAACACACCCATGATTTGAATGTTTAAAAGTTAATGATGGATTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jqbs6mh6