adoa

Ensembl ID:
ENSDARG00000042827
ZFIN ID:
ZDB-GENE-041212-62
Description:
2-aminoethanethiol (cysteamine) dioxygenase a [Source:RefSeq peptide;Acc:NP_001008634]
Human Orthologue:
ADO
Human Description:
2-aminoethanethiol (cysteamine) dioxygenase [Source:HGNC Symbol;Acc:23506]
Mouse Orthologue:
Ado
Mouse Description:
2-aminoethanethiol (cysteamine) dioxygenase Gene [Source:MGI Symbol;Acc:MGI:2685083]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11997 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062858 Nonsense 124 248 1 1
Genomic Location:
Chromosome 12 (position 9229663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCTGAAGGTCCTGTACGGTAAAGTCAGCATCAGGTGTTATGACAAGT[T/A]GGATAAAGCCGAGAGTGACACTGAGAGGCACTTTGAWCCTCCATTGTTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
  • Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)
  • Ewing sarcoma: Common variants near TARDBP and EGR2 are associated with susceptibility to Ewing sarcoma. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jiga80ue