egr2b

Ensembl ID:
ENSDARG00000042826
ZFIN ID:
ZDB-GENE-980526-283
Description:
Early growth response protein 2b [Source:UniProtKB/Swiss-Prot;Acc:Q05159]
Human Orthologue:
EGR2
Human Description:
early growth response 2 [Source:HGNC Symbol;Acc:3239]
Mouse Orthologue:
Egr2
Mouse Description:
early growth response 2 Gene [Source:MGI Symbol;Acc:MGI:95296]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10063 Nonsense Available for shipment Available now
sa18210 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062855 Nonsense 41 412 1 2
ENSDART00000135865 None None 232 None 2
ENSDART00000062855 Nonsense 41 412 1 2
ENSDART00000135865 None None 232 None 2
Genomic Location:
Chromosome 12 (position 9240258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCGGTGGACGAGCTTGSCACAACACTGCCAGCCTCTGTGACTATATA[T/G]AACGATTTAGGAGGACATTACGAGCAGATAAACGYAGGAGGTAAGAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062855 Nonsense 41 412 1 2
ENSDART00000135865 None None 232 None 2
ENSDART00000062855 Nonsense 41 412 1 2
ENSDART00000135865 None None 232 None 2
Genomic Location:
Chromosome 12 (position 9240258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCGGTGGWCGAGCTTGSCACAACACTGCCAGCCTCTGTGACTATATA[T/G]AACGATTTAGGAGGACATTACGAGCAGATAAACGYAGGAGGTAAGAACGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
  • Ewing sarcoma: Common variants near TARDBP and EGR2 are associated with susceptibility to Ewing sarcoma. (View Study)
  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4y9xblf9