LOC795748

Ensembl ID:
ENSDARG00000042825
Human Orthologue:
RNF169
Human Description:
ring finger protein 169 [Source:HGNC Symbol;Acc:26961]
Mouse Orthologue:
Rnf169
Mouse Description:
ring finger protein 169 Gene [Source:MGI Symbol;Acc:MGI:1920257]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42476 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062856 Nonsense 347 630 6 6
Genomic Location (Zv9):
Chromosome 15 (position 4839602)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4989655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGGGCGACTCTTGGAACCAATGATCGTAAAATCAACCCCCAGGAACT[T/A]GACCCGTGCTTTACACAAGTCCACAAGCTACGAGGCTAGTCCGACCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link