nfe2l2

Ensembl ID:
ENSDARG00000042824
ZFIN ID:
ZDB-GENE-030723-2
Description:
nuclear factor erythroid 2-related factor 2 [Source:RefSeq peptide;Acc:NP_878309]
Human Orthologue:
NFE2L2
Human Description:
nuclear factor (erythroid-derived 2)-like 2 [Source:HGNC Symbol;Acc:7782]
Mouse Orthologue:
Nfe2l2
Mouse Description:
nuclear factor, erythroid derived 2, like 2 Gene [Source:MGI Symbol;Acc:MGI:108420]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21416 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062854 Nonsense 388 586 5 5
ENSDART00000126147 Nonsense 388 586 5 6
Genomic Location (Zv9):
Chromosome 9 (position 1669294)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1677799
KASP Assay ID:
2260-1365.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCAGATTACAATGAGATATTCCCATTGGTGTACCTCAACGATGGCTCC[C/T]AGACTCCACTCTCTGAGAAATCCTCGACGGAGAAACAAGAGATGAAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link