agps

Ensembl ID:
ENSDARG00000042821
ZFIN ID:
ZDB-GENE-031118-14
Description:
alkyldihydroxyacetonephosphate synthase, peroxisomal [Source:RefSeq peptide;Acc:NP_956407]
Human Orthologue:
AGPS
Human Description:
alkylglycerone phosphate synthase [Source:HGNC Symbol;Acc:327]
Mouse Orthologue:
Agps
Mouse Description:
alkylglycerone phosphate synthase Gene [Source:MGI Symbol;Acc:MGI:2443065]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21415 Nonsense Mutation detected in F1 DNA During 2014
sa13105 Nonsense Available for shipment Available now
sa5518 Nonsense Mutation detected in F1 DNA During 2014
sa14227 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062850 Nonsense 30 629 1 20
ENSDART00000143130 None None 230 None 8
Genomic Location:
Chromosome 9 (position 1629144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACAGGCTGAGGATCATCGCCGGACACTTGCAGAAGCGCACAGAAGAT[C/T]AACACACCAGTCTCTCCGCGCAAAACTGCAGAGCCGAGTCTCCCGGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062850 Nonsense 156 629 4 20
ENSDART00000143130 None None 230 None 8
Genomic Location:
Chromosome 9 (position 1616314)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAGCTGCAGGTCTGCTGGCGTCTCATGATGCGGAGGATCGGGTTTTC[C/T]GAGCTCATGGTAAAACACACACACACACACACACACACACACACACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062850 Nonsense 382 629 11 20
ENSDART00000143130 None None 230 None 8
Genomic Location:
Chromosome 9 (position 1599250)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCCCCAACTTCCAGCAGGGTGTGGCGTGTCTGAGAGAGGTGGCCCGA[C/T]AGGTCAGCACTACACACACACACACACACTNNNNNNNNNNAGTGATATTCARATTAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062850 Nonsense 396 629 12 20
ENSDART00000143130 None None 230 None 8
Genomic Location:
Chromosome 9 (position 1598918)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTTTCAGAGATGTGCTCCAGCATCTATTCGGCTAATGGACAACGAG[C/T]AGTTTCAGTTCGGTGAGTTWAWTGTTATCTTCAGATCTRCAAAAGATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f16bqjgw