mmp9

Ensembl ID:
ENSDARG00000042816
ZFIN ID:
ZDB-GENE-040426-2132
Description:
matrix metalloproteinase-9 [Source:RefSeq peptide;Acc:NP_998288]
Human Orthologue:
MMP9
Human Description:
matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) [Source:HGNC S
Mouse Orthologue:
Mmp9
Mouse Description:
matrix metallopeptidase 9 Gene [Source:MGI Symbol;Acc:MGI:97011]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12776 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062845 Essential Splice Site 607 680 11 13

The following transcripts of ENSDARG00000042816 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 25147341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGAGGAAAAGGCAAGGTGCTCCTGTTTAATGGAGAAAACTTCTGGAG[G/A]TAARTAACTATAACTAAGAGCTGATCAGAAAGTGTACTAATTTTAGAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pygkhkes