mmp9

Ensembl ID:
ENSDARG00000042816
ZFIN ID:
ZDB-GENE-040426-2132
Description:
matrix metalloproteinase-9 [Source:RefSeq peptide;Acc:NP_998288]
Human Orthologue:
MMP9
Human Description:
matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) [Source:HGNC S
Mouse Orthologue:
Mmp9
Mouse Description:
matrix metallopeptidase 9 Gene [Source:MGI Symbol;Acc:MGI:97011]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34399 Nonsense Mutation detected in F1 DNA During 2016
sa12776 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062845 Nonsense 231 680 5 13

The following transcripts of ENSDARG00000042816 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25144743)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24270561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCTTCAGCCATTCAAACCCGCTACGGTAATGCTGAGGGTGCAATGTG[T/A]CACTTCCCCTTCCTGTTTGAGGGAACATCCTACTCCACCTGCACCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062845 Essential Splice Site 607 680 11 13

The following transcripts of ENSDARG00000042816 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25147341)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24273159
KASP Assay ID:
2260-0575.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGAGGAAAAGGCAAGGTGCTCCTGTTTAATGGAGAAAACTTCTGGAG[G/A]TAARTAACTATAACTAAGAGCTGATCAGAAAGTGTACTAATTTTAGAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link