yy1a

Ensembl ID:
ENSDARG00000042796
ZFIN ID:
ZDB-GENE-030131-1117
Description:
transcriptional repressor protein YY1 [Source:RefSeq peptide;Acc:NP_997782]
Human Orthologues:
YY1, YY2
Human Descriptions:
YY1 transcription factor [Source:HGNC Symbol;Acc:12856]
YY2 transcription factor [Source:HGNC Symbol;Acc:31684]
Mouse Orthologues:
Yy1, Yy2
Mouse Descriptions:
YY1 transcription factor Gene [Source:MGI Symbol;Acc:MGI:99150]
Yy2 transcription factor Gene [Source:MGI Symbol;Acc:MGI:3837947]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7439 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062811 Missense 167 357 1 5
Genomic Location:
Chromosome 17 (position 30921748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAACAAGTGCAGATCAAAACACTGGAGGGGGAGTTTTCCGTCACTATG[T/C]GGGCATCGGGTAAGTTTTGACATCGCATCAAGTGCTTTGTTCTCGCGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5tuhueqp