tpp1

Ensembl ID:
ENSDARG00000042793
ZFIN ID:
ZDB-GENE-030131-6654
Description:
tripeptidyl-peptidase 1 [Source:RefSeq peptide;Acc:NP_001122270]
Human Orthologue:
TPP1
Human Description:
tripeptidyl peptidase I [Source:HGNC Symbol;Acc:2073]
Mouse Orthologue:
Tpp1
Mouse Description:
tripeptidyl peptidase I Gene [Source:MGI Symbol;Acc:MGI:1336194]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11 Nonsense Confirmed mutation in F2 line During 2014
sa8389 Nonsense Mutation detected in F1 DNA During 2014
sa2895 Essential Splice Site F2 line generated During 2014
sa6483 Nonsense Mutation detected in F1 DNA During 2014
hu3587 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa11
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Nonsense 40 557 3 13
Genomic Location:
Chromosome 17 (position 30905096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTAGTGTACCTGGGGACTGGACATTTCTTGGACGGGTTGGACCAT[T/A]GGAAGAAGTTGAACTAACGTTTGCGCTGAAGCAGCAGAATGTTAGCAAGA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 48 hpf

Control on top; Mutant below; 48 hpf

zoom

Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
whole organism
ZFA:0001094
decreased size
PATO:0000587
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
17:32835601-32836033 32836033 1 2.64 × 10-04 -2.3 -8 ctsba ENSDARG00000055120
4:44019401-44019634 44019634 1 7.90 × 10-04 1.8 -51 CU278559.2 ENSDARG00000087914
20:54323101-54323400 54322502 -1 1.95 × 10-03 2.0 -1 hsp90aa1.2 ENSDARG00000024746
23:21763346-21763800 21763346 -1 3.02 × 10-03 -1.5 -1 her4.2 ENSDARG00000056729
19:1978501-1978800 1975674 -1 3.44 × 10-03 0.9 4 rplp1 ENSDARG00000021864

Mutation Details

Allele Name:
sa8389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Nonsense 98 557 4 13
Genomic Location:
Chromosome 17 (position 30905371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCTCTTTCCAGACCTTCTCCGCTGACTGAAAAAGTGSTAGAGAATTG[G/A]CTTCGGAGTCATGGGGTCATGGACTGTCACACTATTAWAACACGGGAYTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2895
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Essential Splice Site 377 557 9 13
Genomic Location:
Chromosome 17 (position 30908710)
KASP Assay ID:
554-2511.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGACCAAAGAAAGAAATACCTTTAGGCCAAGTTTTCCTGCTTCCAGG[T/C]GGATATTGCTTTCTAAATAATCTGTATAATACTGATRAACTGATTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Nonsense 396 557 10 13
Genomic Location:
Chromosome 17 (position 30908839)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACCACTGTGGGTGGGACTTCTTTTCAAAACCCCTTCAAACTCAGCTA[T/A]GAGGTCACAGATTACATCAGCGGAGGCRGCTTCAGTAATGTGTTTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3587
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Nonsense 444 557 11 13
Genomic Location:
Chromosome 17 (position 30911241)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGTCTCTTCCTCCTCAGACATATTTTAACACCACTGGAAGAGCTTA[T/A]CCAGACCTAGCGGCGCTTTCTGACAACTACTGGGTCGTCTCCAACCGTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/selaghmc