git2b

Ensembl ID:
ENSDARG00000042791
ZFIN ID:
ZDB-GENE-070112-2192
Description:
G protein-coupled receptor kinase interacting ArfGAP 2 [Source:RefSeq peptide;Acc:NP_001073657]
Human Orthologue:
GIT2
Human Description:
G protein-coupled receptor kinase interacting ArfGAP 2 [Source:HGNC Symbol;Acc:4273]
Mouse Orthologue:
Git2
Mouse Description:
G protein-coupled receptor kinase-interactor 2 Gene [Source:MGI Symbol;Acc:MGI:1347053]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34972 Nonsense Mutation detected in F1 DNA During 2016
sa13702 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062786 Nonsense 225 736 7 23
ENSDART00000062795 Nonsense 225 736 7 22
ENSDART00000113582 Nonsense 225 736 7 20
Genomic Location (Zv9):
Chromosome 10 (position 41662020)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40374729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAAGCCGGGCACCAGGACCTCGCAGACAGACTGGTGGAGATCCAGTTT[G/T]AGCTGACAGACAGACTAGCGTTCTACCTGTGTGGAAGAAAGCCAGGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062786 Essential Splice Site 366 736 12 23
ENSDART00000062795 Essential Splice Site 366 736 12 22
ENSDART00000113582 Essential Splice Site 366 736 12 20
Genomic Location (Zv9):
Chromosome 10 (position 41663017)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40375726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGATGCCAAACGRCGTCAGCTGGGGAATTCTYCTGATAATGTTAAAG[G/A]TGAGGWACATCTTYRATTACTCTCTTRTYGTTAAAGGAATAGTTCACCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link