ppp4r1

Ensembl ID:
ENSDARG00000042781
ZFIN ID:
ZDB-GENE-040426-753
Description:
protein phosphatase 4, regulatory subunit 1 [Source:RefSeq peptide;Acc:NP_956554]
Human Orthologue:
PPP4R1L
Human Description:
protein phosphatase 4, regulatory subunit 1-like [Source:HGNC Symbol;Acc:15755]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7637 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062798 Missense 136 315 5 6
Genomic Location (Zv9):
Chromosome Zv9_NA119 (position 1650)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149734.1 1650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACCTCCCAGCTCYGAGACGCCGCTCCTGTGTGTTTCCCACAATGCAC[T/C]GGGGTGTGAGGAGCCAGACGTAGCRGAGGAGGGYGGMGGAGAGCAGCCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link