apob

Ensembl ID:
ENSDARG00000042780
ZFIN ID:
ZDB-GENE-070702-4
Human Orthologue:
APOB
Human Description:
apolipoprotein B (including Ag(x) antigen) [Source:HGNC Symbol;Acc:603]
Mouse Orthologue:
Apob
Mouse Description:
apolipoprotein B Gene [Source:MGI Symbol;Acc:MGI:88052]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7832 Nonsense Mutation detected in F1 DNA During 2014
sa13626 Nonsense Available for shipment Available now
sa13822 Nonsense Available for shipment Available now
sa8678 Nonsense Mutation detected in F1 DNA During 2014
sa11961 Nonsense Available for shipment Available now
sa2934 Nonsense Mutation detected in F1 DNA During 2014
sa6482 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1158 4418 22 29
Genomic Location:
Chromosome 17 (position 30775220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAGATTTGAACTATTTTKACTTTGCAGATAATAACAAGGTTGAAATT[G/T]AAATGAAGTCAGACATAAACTCTGAGGTTGAGAAACTTTTTCCAAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1247 4418 23 29
Genomic Location:
Chromosome 17 (position 30775578)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGAAGCACCCCAGAGCTCATATTGCCATCTTTGCCAGAAAAACTGTA[T/A]CTTAAATCGTAAGTGACACGTTAATGGACTCCTTAACAATATCTGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1322 4418 24 29
Genomic Location:
Chromosome 17 (position 30777052)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCCAWCGTTCACAATTCCCCGCACTTTGGAATTCTCCTTACCCATGT[T/A]GGGTGTRGCAGAGCTGTCAGCTAAGATGAACAGCAACTTTTATGAATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1726 4418 25 29
Genomic Location:
Chromosome 17 (position 30778451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCATGAGGGGTACTTTGCAAAAAATGAGATCAGAGTGCATGCAAACTT[T/A]GAACATAACTTTATGGACCTTGGCTTTCCGTTCCAAAAHSGACAATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 2233 4418 25 29
Genomic Location:
Chromosome 17 (position 30779972)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCTGAGTGAACTGAGGAAGGTTGTTGAGACATTTGAWATCAACATGT[T/A]ACTTGARGATCTGAGACAATATATAAYCTCAATTGAYTTGACTGAATAYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 3013 4418 25 29
Genomic Location:
Chromosome 17 (position 30782311)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACAGTAAAATTAWCTTGCCCCTCAAGCTGACTGGAAAAATYGACCTC[C/T]AGGATGACTTTGGATTTACTTTAAATTCCAATAAGCAACATGCATTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 3431 4418 25 29
Genomic Location:
Chromosome 17 (position 30783567)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACTGGAAGCATTGATCACAATTTTGCCCTAGAGGCACTGTCATCCTA[T/G]ATCTCTTTGGAGAGCRCTTGGAAAGGAACAACAGATTCAACAATCATGGW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c7wpe3l0