apob

Ensembl ID:
ENSDARG00000042780
ZFIN ID:
ZDB-GENE-070702-4
Human Orthologue:
APOB
Human Description:
apolipoprotein B (including Ag(x) antigen) [Source:HGNC Symbol;Acc:603]
Mouse Orthologue:
Apob
Mouse Description:
apolipoprotein B Gene [Source:MGI Symbol;Acc:MGI:88052]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42959 Nonsense Mutation detected in F1 DNA During 2016
sa36449 Nonsense Mutation detected in F1 DNA During 2016
sa36450 Nonsense Mutation detected in F1 DNA During 2016
sa13626 Nonsense Available for shipment Available now
sa13822 Nonsense Available for shipment Available now
sa8678 Nonsense Mutation detected in F1 DNA During 2016
sa11961 Nonsense Available for shipment Available now
sa6482 Nonsense Mutation detected in F1 DNA During 2016
sa36451 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 447 4418 10 29
Genomic Location (Zv9):
Chromosome 17 (position 30768024)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30691951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGGAATATTAACATATTAACCTATATTTTGCAGGCTTCCTCAAGAT[C/T]AAGCAACATCCACGCCTGAAGTGAAAGAAGTAGCTAAATTCATGGAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 541 4418 12 29
Genomic Location (Zv9):
Chromosome 17 (position 30768769)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30692696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTGTTTCTAGGTGAGAAGTGCTCTGATTCAACAATATCAGAATGTC[G/T]AAGCACCTGCCCAAAAACGTATTGCAGCATATCTGATGCTTATGAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 601 4418 13 29
Genomic Location (Zv9):
Chromosome 17 (position 30769616)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30693543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTATTGCATTCCTAATTTTGTTGTATATGTTTTTAGAGCAAAGGACTA[C/A]ATTCTTAAAGCTGTACAAGGAGATGTGAGCTTTCCCCCTATGGACTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1247 4418 23 29
Genomic Location (Zv9):
Chromosome 17 (position 30775578)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30699505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGAAGCACCCCAGAGCTCATATTGCCATCTTTGCCAGAAAAACTGTA[T/A]CTTAAATCGTAAGTGACACGTTAATGGACTCCTTAACAATATCTGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1322 4418 24 29
Genomic Location (Zv9):
Chromosome 17 (position 30777052)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30700979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCCAWCGTTCACAATTCCCCGCACTTTGGAATTCTCCTTACCCATGT[T/A]GGGTGTRGCAGAGCTGTCAGCTAAGATGAACAGCAACTTTTATGAATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1726 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30778451)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30702378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCATGAGGGGTACTTTGCAAAAAATGAGATCAGAGTGCATGCAAACTT[T/A]GAACATAACTTTATGGACCTTGGCTTTCCGTTCCAAAAHSGACAATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 2233 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30779972)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30703899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCTGAGTGAACTGAGGAAGGTTGTTGAGACATTTGAWATCAACATGT[T/A]ACTTGARGATCTGAGACAATATATAAYCTCAATTGAYTTGACTGAATAYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 3431 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30783567)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30707494
KASP Assay ID:
554-5449.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACTGGAAGCATTGATCACAATTTTGCCCTAGAGGCACTGTCATCCTA[T/G]ATCTCTTTGGAGAGCRCTTGGAAAGGAACAACAGATTCAACAATCATGGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Essential Splice Site 3902 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30784982)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30708909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTCCACCTGCACTTCCACCATGGTTTTCCTGGAGTACAACTTAGATG[G/A]TAAGCTTTAAAGACTTTTACAAGTTTATAAGGATCTATATTACTGTGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link