galnt10

Ensembl ID:
ENSDARG00000042778
ZFIN ID:
ZDB-GENE-030131-595
Description:
polypeptide N-acetylgalactosaminyltransferase 10 [Source:RefSeq peptide;Acc:NP_001070072]
Mouse Orthologue:
Galntl6
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6 Gene [Source

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37386 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092411 Nonsense 54 261 2 8
ENSDART00000136780 Nonsense 54 180 2 4
ENSDART00000146245   None 142 None 3
Genomic Location (Zv9):
Chromosome 21 (position 44216350)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45847691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTTAGAAAGTGAACAGAAAG[C/T]AAGTGCTGAAGGATGGCGTCCGGAAGAAGGACTGGCATGACTATGCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link