cnst

Ensembl ID:
ENSDARG00000042759
ZFIN ID:
ZDB-GENE-041001-189
Description:
consortin, connexin sorting protein [Source:RefSeq peptide;Acc:NP_001020712]
Human Orthologue:
CNST
Human Description:
consortin, connexin sorting protein [Source:HGNC Symbol;Acc:26486]
Mouse Orthologue:
Cnst
Mouse Description:
consortin, connexin sorting protein Gene [Source:MGI Symbol;Acc:MGI:2445141]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43491 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16439 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062761 Essential Splice Site 200 398 7 10
Genomic Location:
Chromosome 20 (position 35024878)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATAATCTGACAAAACTTTCTTTCAGACCAAACCTCTCTGTGCAAAAG[G/A]TAAAACATTACAACTTCCTTATTCTCCTCCAATGCATTTTATTTTCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062761 Nonsense 380 398 10 10
Genomic Location:
Chromosome 20 (position 35016425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTACTCGAATGTGTGCATCGACTTCTCTCAGAACATGGACTTTTACTTT[G/T]GACCTGTASGACRAACAGTGRCTGCTCTTACACAGTGGTTCACTTCTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link