ctskl

Ensembl ID:
ENSDARG00000042753
ZFIN ID:
ZDB-GENE-050208-336
Description:
Novel protein similar to vertebrate cathepsin family [Source:UniProtKB/TrEMBL;Acc:Q1LXE8]
Human Orthologue:
CTSH
Human Description:
cathepsin H [Source:HGNC Symbol;Acc:2535]
Mouse Orthologue:
Ctsh
Mouse Description:
cathepsin H Gene [Source:MGI Symbol;Acc:MGI:107285]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12959 Essential Splice Site Available for shipment Available now
sa1007 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062749 Essential Splice Site 96 349 3 8
ENSDART00000137497 Essential Splice Site 58 264 2 7

The following transcripts of ENSDARG00000042753 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 16634016)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTYGGAWTGTCAATGTTTAAAATGGCAATGAACAAATATGGAGACCTGG[T/A]AAGTAAATCGGAATTAAATATCCATTTATCTGAAAATAACCAYTGAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062749 Nonsense 312 349 7 8
ENSDART00000137497 Nonsense 227 264 6 7

The following transcripts of ENSDARG00000042753 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 16629477)
KASP Assay ID:
554-0911.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCTGTGCTGGTGGTTGGTTACGGCTCMGAGGAGGGCACAGATTACTG[G/A]ATAATCAAGAACAGGTGAGAGAAAACGCCCTTCATTTACATTTRTGCCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fp9qft06